1Department of Pediatrics, Ajou University School of Medicine, Suwon, Korea
2Department of Radiation Oncology, Ajou University School of Medicine, Suwon, Korea
3Department of Pathology, Ajou University School of Medicine, Suwon, Korea
4Department of Pediatrics, Seoul National University Bundang Hospital, Seongnam, Korea
5Department of Pediatric Hematology and Oncology, Yonsei Cancer Center, Yonsei University Health System, Seoul, Korea
6Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea
7Department of Medical Genetics, Ajou University School of Medicine, Suwon, Korea
Copyright © 2020 by the Korean Cancer Association
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
| Study | Source of study | No. of patients | Prevalence of LOH 1p/16q/both (%) | HR or RR | p-value |
|---|---|---|---|---|---|
| Grundy et al. [10] | NWTS-3,4 | 232 | 12/17/4 | RR 3.3 for 16q vs. none | 0.01 |
| Grundy et al. [6] | NWTS-5 | 1,727 | 11.3/17.4/4.6 | Stage I-II, RR 2.9 (95% CI, 1.51-5.49) for both vs. none, 1p only, and 16q only stage III-IV, RR 2.4 (95% CI, 1.20-4.82) for both vs. none, 1p only, and 16q only | 0.001 |
| Messahel et al. [11] | UKW 1-3 | 426 | 10.3/17.4/2.6 | HR 2.64 (95% CI, 1.47-4.92) for 16q vs. none | < 0.001 |
| Spreafico et al. [13] | AIEOP-TW-2003 | 125 | 19/14/4 | HR 4.1 (95% CI, 1.60-10.8) for 1p vs. none | 0.0009 |
| Fawzy et al. [12] | National Cancer Institute, Egypt | 100 | 26/25/12 | 53.8%a), 50% for 16q only, and both vs. 1p only | 0.007 |
| This study | K-PHOG | 101 | 18.8/18.8/5 | HR 3.84 (95% CI, 1.31-13.0) for 16q vs. none | 0.031 |
| No. | Name | Forward primer | Reverse primer | Size (bp) | Location | Tube no. |
|---|---|---|---|---|---|---|
| 1 | D1S244 | VIC: GAGCAGCACCGTACAAAT | AGCTCCGCTCCCTGTAAT | 285-296 | 1p36.22 | 1 |
| 2 | D1S468 | 6FAM: AATTAACCGTTTTGGTCCT | GCGACACACACTTCCC | 173-191 | 1p36.33 | 1 |
| 3 | D1S2870 | PET: GATCATGCCAATGCACTAT | CCAGGGTGACACAGCA | 190-212 | 1p36.31 | 1 |
| 4 | D1S214 | 6FAM: CCGAATGACAAGGTGAGACT | AATGTTGTTTCCAAAGTGGC | 120-142 | 1p36.31 | 1 |
| 5 | D1S1612 | NED: TCCCATGCCAAAATTCTTAG | GAAAGAAAGAGAAAGAAGGAAGG | 94-130 | 1p36.23 | 1 |
| 6 | D1S243 | PET: CACACAGGCTCACATGCC | GCTCCAGCGTCATGGACT | 142-170 | 1p36.33 | 2 |
| 7 | D1S450 | NED: GCTCCAATGTCCAAGGG | GGGTACTCAGATGGCTGGT | 243-267 | 1p36.22 | 2 |
| 8 | D16S518 | 6FAM: GGCCTTTTGGCAGTCA | ACCTTGGCCTCCCACC | 271-290 | 16q23.1 | 3 |
| 9 | D16S3025 | PET: TCCATTGGACTTATAACCATG | AGCTGAGAGACATCTGGG | 90-110 | 16q22.1 | 2 |
| 10 | D16S3043 | 6FAM: CATTAATATGGAGCCTTATAGATTG | AAATGTTGAGCACTTGAATAAAAT | 118-150 | 16q21 | 2 |
| 11 | D16S400 | 6FAM: GTCATCCGACTTCTCACAGG | AATATGAACCCTCCATGCTG | 192-202 | 16q21 | 3 |
| 12 | D16S421 | VIC: ACATGAACCGATTGGACTGA | CCGTTCCCTATATTTCCTGG | 206-216 | 16q22.1 | 2 |
| 13 | D16S422 | NED: CAGTGTAACCTGGGGGC | CTTTCGATTAGTTTAGCAGAATGAG | 188-212 | 16q23.3 | 2 |
| 14 | D16S2621 | PET: GTCATATGGGCCAATTCCC | TACCGCGTAGTGAGACTGTG | 239-263 | 16q24.2 | 3 |
| 15 | D16S2624 | VIC: TGAGGCAATTTGTTACAGAGC | TAATGTACCTGGTACCAAAAACA | 132-148 | 16q22.2 | 3 |
| 16 | D16S3101 | NED: TTCCTGAATGTCATGTAGTTGG | TGTCATCGGGGCTTGTAG | 158-166 | 16q23.1 | 2 |
| Patient characteristic | No. of patients (%) (n=101) |
|---|---|
| Age at diagnosis (yr) | |
| Mean (range) | 2.8 (0.3-10.4) |
| < 2 | 52 (51.5) |
| 2-10 | 23 (22.8) |
| > 10 | 26 (25.7) |
| Sex | |
| Male | 48 (47.5) |
| Female | 53 (52.5) |
| Primary tumor site | |
| Right | 43 (42.6) |
| Left | 52 (51.5) |
| Both | 6 (5.9) |
| Stage | |
| I | 25 (24.8) |
| II | 15 (14.9) |
| III | 43 (42.6) |
| IV | 12 (11.9) |
| V | 6 (5.9) |
| Treatment strategy | |
| NWTS-4 | 53 (52.5) |
| Modified NWTS-4 | 48 (47.5) |
| Nephrectomy | |
| Upfront | 54 (53.4) |
| Delayed | 47 (46.5) |
| Metastasis to lung at diagnosis | 11 (10.9) |
| Loss of heterozygosity for 1p/16q | |
| 1p only | 14 (13.9) |
| 16q only | 14 (13.9) |
| Both 1p and 16q | 5 (5.0) |
| Patient characteristic | No. of patients (%) |
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1p (−) (n=82) | 1p (+) (n=19) | p-value | 16q (−) (n=82) | 16q (+) (n=19) | p-value | 1p only (n=14) | 16q only (n=14) | 1p and 16q (n=5) | None (n=68) | p-value | |
| Age at diagnosis (yr) | |||||||||||
| < 2 | 43 (52.4) | 9 (47.4) | 0.049 | 42 (51.2) | 10 (52.6) | 0.427 | 8 (57.1) | 9 (64.3) | 1 (20.0) | 34 (50.0) | 0.116 |
| 2-4 | 15 (18.3) | 8 (42.1) | 17 (20.7) | 6 (31.6) | 5 (35.7) | 3 (21.4) | 3 (60.0) | 12 (17.6) | |||
| > 4 | 24 (29.3) | 2 (10.5) | 23 (28.0) | 3 (15.8) | 1 (7.1) | 2 (14.3) | 1 (20.0) | 22 (32.4) | |||
| Stage | |||||||||||
| I | 19 (23.2) | 6 (31.6) | 0.411 | 24 (29.3) | 1 (5.3) | 0.086 | 6 (42.9) | 1 (7.1) | 0 | 18 (26.5) | 0.226 |
| II | 13 (15.9) | 2 (10.5) | 12 (14.6) | 3 (15.8) | 2 (14.3) | 3 (21.4) | 0 | 10 (14.7) | |||
| III | 36 (43.9) | 7 (36.8) | 30 (36.6) | 13 (68.4) | 3 (21.4) | 9 (64.3) | 4 (80.0) | 27 (39.7) | |||
| IV | 8 (9.8) | 4 (21.1) | 11 (13.4) | 1 (5.3) | 3 (21.4) | 0 | 1 (20.0) | 8 (11.8) | |||
| V | 6 (7.3) | 0 | 5 (6.1) | 1 (5.3) | 0 | 1 (7.1) | 0 | 5 (7.4) | |||
| Event-free survival (3-year) (%) | Hazard ratio (95% CI) | p-value | |
|---|---|---|---|
| Age (yr) | |||
| < 2 | 90.0 | 1 | |
| 2-4 | 91.3 | 0.84 (0.15-4.53) | 0.835 |
| > 4 | 79.6 | 2.40 (0.67-8.55) | 0.176 |
| Stage | |||
| I-II | 90.6 | 1 | |
| III-V | 84.5 | 1.11 (0.24-5.15) | 0.893 |
| Treatment strategy | |||
| NWTS-4 | 88.2 | 1 | |
| Modified NWTS-4 | 86.9 | 0.73 (0.15-3.51) | 0.695 |
| LOH 1p | |||
| Absent | 82.7 | 1 | |
| Present | 89.5 | 0.83 (0.17-4.01) | 0.817 |
| LOH 16q | |||
| Absent | 91.1 | 1 | |
| Present | 73.7 | 3.95 (1.08-14.39) | 0.037 |
| Study | Source of study | No. of patients | Prevalence of LOH 1p/16q/both (%) | HR or RR | p-value |
|---|---|---|---|---|---|
| Grundy et al. [10] | NWTS-3,4 | 232 | 12/17/4 | RR 3.3 for 16q vs. none | 0.01 |
| Grundy et al. [6] | NWTS-5 | 1,727 | 11.3/17.4/4.6 | Stage I-II, RR 2.9 (95% CI, 1.51-5.49) for both vs. none, 1p only, and 16q only stage III-IV, RR 2.4 (95% CI, 1.20-4.82) for both vs. none, 1p only, and 16q only | 0.001 |
| Messahel et al. [11] | UKW 1-3 | 426 | 10.3/17.4/2.6 | HR 2.64 (95% CI, 1.47-4.92) for 16q vs. none | < 0.001 |
| Spreafico et al. [13] | AIEOP-TW-2003 | 125 | 19/14/4 | HR 4.1 (95% CI, 1.60-10.8) for 1p vs. none | 0.0009 |
| Fawzy et al. [12] | National Cancer Institute, Egypt | 100 | 26/25/12 | 53.8%a), 50% for 16q only, and both vs. 1p only | 0.007 |
| This study | K-PHOG | 101 | 18.8/18.8/5 | HR 3.84 (95% CI, 1.31-13.0) for 16q vs. none | 0.031 |
NWTS-4, National Wilms’ Tumor Study 4.
LOH, loss of heterozygosity; CI, confidence interval; NWTS-4, National Wilms’ Tumor Study 4.
LOH, loss of heterozygosity; HR, hazard ratio; RR, relative risk (Cox model for relapse or events for specific LOH); NWTS-4, National Wilms’ Tumor Study 4; CI, confidence interval. a)Event-free survival rate according to the Kaplan-Meier analysis and compared with the log-rank test.
