1Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea
2Department of Pathology, Seoul National University College of Medicine, Seoul, Korea
3Department of Pediatrics, Cancer Research Institute, Seoul National University College of Medicine, Seoul, Korea
Copyright © 2018 by the Korean Cancer Association
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
| Exon | Primer sequence | Annealing temperature (°C) |
|---|---|---|
| ALK exon 23 | ||
| F | AGATTTGCCCAGACTCAGCTC | 58 |
| R | GGTCTCTCGGAGGAAGGACT | |
| ALK exon 24 | ||
| F | CTTCTGTCTCCCCACAGAGC | 58 |
| R | AAGCACACAGATCAGCGACA | |
| ALK exon 25 | ||
| F | TGATGGCCGTTGTACACTCA | 58 |
| R | CTGAGGTGGAAGAGACAGGC |
| Characteristic | No. (%) |
|---|---|
| Age, median (range, mo) | 2.0 (0.0-16.7) |
| Sex | |
| Male | 36 (50.0) |
| Female | 36 (50.0) |
| Primary site | |
| Abdomen | 55 (76.4) |
| Posterior mediastinum | 15 (20.8) |
| Neck | 2 (2.8) |
| INSS stage | |
| Stage I | 16 (22.2) |
| Stage II | 8 (11.1) |
| Stage III | 16 (22.2) |
| Stage IV | 31 (43.1) |
| Stage IVs | 1 (1.4) |
| Risk group | |
| Low risk | 24 (33.3) |
| Intermediate risk | 21 (29.2) |
| High risk | 27 (37.5) |
| MYCN amplification | |
| Positive | 7/70 (10.0) |
| Negative | 63/70 (90.0) |
| ALK IHC | |
| Positive | 40 (55.6) |
| Negative | 32 (44.4) |
| ATRX IHC | |
| Loss | 9/69 (13.0) |
| No loss | 60/69 (87.0) |
| TERT IHC | |
| Positive | 42/71 (59.2) |
| Negative | 29/71 (40.8) |
| Patient No. | Sex | Age at diagnosis (yr) | INSS stage | MYCN amplification | ALK IHC | ATRX IHC | TERT IHC | Time to relapse (mo) | Outcome/Survival time from relapse (mo) |
|---|---|---|---|---|---|---|---|---|---|
| 4 | M | 3.2 | IV | – | – | No loss | – | 45.1 | AWD, 90.4 |
| 6 | M | 9.8 | III | – | – | No loss | + | 42.5 | DOD, 42.0 |
| 23 | M | 12.2 | IV | – | + | Loss | + | 46.5 | DOD, 55.2 |
| 27 | M | 1.5 | IV | – | + | No loss | – | 83.7 | AWD, 1.0 |
| 28 | M | 7.0 | III | – | – | No loss | + | 11.8 | DOD, 3.7 |
| 31 | M | 7.6 | IV | – | + | No loss | – | 32.8 | DOD, 20.4 |
| 33 | F | 5.3 | IV | NA | + | No loss | – | 21.4 | DOD, 1.9 |
| 37 | F | 0.5 | IV | + | + | No loss | + | 3.4 | DOD, 1.2 |
| 38 | F | 3.6 | IV | – | + | Loss | – | 27.9 | DOD, 55.3 |
| 47 | M | 4.6 | IV | – | + | Loss | + | 25.9 | DOD, 5.6 |
| 50 | M | 2.0 | IV | + | + | No loss | + | 18.8 | DOD, 25.5 |
| 67 | M | 3.3 | IV | – | + | No loss | + | 27.5 | AWD, 17.4 |
| 72 | M | 2.3 | IV | + | + | No loss | – | 9.0 | DOD, 5.8 |
| 75 | F | 1.9 | IV | + | + | No loss | – | 15.6 | DOD, 4.3 |
| 76 | F | 2.7 | IV | – | + | No loss | – | 13.5 | DOD, 1.8 |
| 81 | M | 4.4 | IV | – | + | No loss | + | 13.2 | DOD, 2.2 |
| Patient No. | Age (yr) | INSS stage | MYCN amplification | ALK IHC | ATRX IHC | TERT IHC | Outcome |
|---|---|---|---|---|---|---|---|
| 13 | 1.3 | I | – | – | Loss | + | NED |
| 17 | 1.9 | I | – | – | Loss | + | NED |
| 86 | 12.9 | I | – | + | Loss | – | NED |
| 21 | 0.2 | II | – | – | Loss | + | NED |
| 26 | 2.2 | III | – | – | Loss | + | NED |
| 23 | 12.2 | IV | – | + | Loss | + | DOD |
| 38 | 3.6 | IV | – | + | Loss | – | DOD |
| 39 | 10.8 | IV | – | + | Loss | – | NED |
| 47 | 4.6 | IV | – | + | Loss | + | DOD |
PCR, polymerase chain reaction; ALK, anaplastic lymphoma kinase; F, forward primer; R, reverse primer.
INSS, International Neuroblastoma Staging System; ALK, anaplastic lymphoma kinase; IHC, immunohistochemistry; ATRX, alpha thalassemia/mental retardation syndrome X-linked; TERT, telomerase reverse transcriptase.
INSS, International Neuroblastoma Staging System; ALK, anaplastic lymphoma kinase; IHC, immunohistochemistry; ATRX, alpha thalassemia/mental retardation syndrome X-linked; TERT, telomerase reverse transcriptase; M, male; AWD, alive with disease; DOD, died of disease; F, female; NA, not assessable.
ATRX, alpha thalassemia/mental retardation syndrome X-linked; INSS, International Neuroblastoma Staging System; ALK, anaplastic lymphoma kinase; IHC, immunohistochemistry; TERT, telomerase reverse transcriptase; NED, no evidence of disease.
